View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18050_low_27 (Length: 254)
Name: NF18050_low_27
Description: NF18050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18050_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 10258483 - 10258369
Alignment:
| Q |
1 |
acatcatcatttagtacttttgaactcttgctgaatgtccgttgtatcgaaccaagcaacccaattcggtgacctacaacaactcataaactaagaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10258483 |
acatcatcatttagtacttttgaactcttgctgaatgtccgttgtatcgaaccaagcaacccaattcggtgacctacaacaactcataaactaagaactc |
10258384 |
T |
|
| Q |
101 |
taacattcacatata |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10258383 |
taacattcacatata |
10258369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 152 - 239
Target Start/End: Complemental strand, 10258330 - 10258243
Alignment:
| Q |
152 |
ccttttaagtcaacgtgatttgtcggtgatccatctctcttgaacacaactttcccattatcaacagcaaaaacccaacaatcctttg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10258330 |
ccttttaagtcaacgtgatttgtcggtgatccatctctcttgaacacaactttcccattatcaacagcaaaaacccaacaatcctttg |
10258243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University