View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18050_low_31 (Length: 236)
Name: NF18050_low_31
Description: NF18050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18050_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 27 - 224
Target Start/End: Original strand, 41067297 - 41067494
Alignment:
| Q |
27 |
aactatgctgcctgctgatggtttccaatgggatgcacttactcttgctaagcaagctctatcagcctcaaaacaagccgctgcagtggctcaagagttg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41067297 |
aactatgctgcctgctgatggtttccaatgggatgcacttactcttgctaagcaagctctatcagcctcaaaacaagccgctgcagttgctcaagagttg |
41067396 |
T |
 |
| Q |
127 |
aaattggttaaaattgacgatgatgattcactacctcttgggttagttctagctttggcatccttgatttggctttttatctgtttatatgttatttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41067397 |
aaattggttaaaattgacgatgatgattcactacctcttgggttagttctagctttggcatccttgatttggctttttatctgtttatatgttatttt |
41067494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University