View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18051_high_14 (Length: 271)

Name: NF18051_high_14
Description: NF18051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18051_high_14
NF18051_high_14
[»] chr5 (1 HSPs)
chr5 (7-254)||(990274-990521)


Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 7 - 254
Target Start/End: Original strand, 990274 - 990521
Alignment:
7 ggaattagctttgagaatctttggtgagatgccagagagtaatcttgtatcttggaacacaatgattggtgccatggttcaagcaagcatgtttgaggaa 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
990274 ggaattagctttgagaatctttggtgagatgccagagagtaatcttgtatcttggaacacaatgattggtgccatggttcaagcaagcatgtttgaggaa 990373  T
107 gcaattgatttattcagggagatgcaaaaccaagggattaaaggagatagagtgacaatggtgggtattgcttctgcctgtggatatttaggagctcttg 206  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
990374 gcaattgatttactcagggagatgcaaaaccaagggattaaaggagatagagtgacaatggtgggtattgcttctgcctgtggatatttaggagctcttg 990473  T
207 atcttgctaagtggatctatacttacattgagaaaaatgacattcaca 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
990474 atcttgctaagtggatctatacttacattgagaaaaatgacattcaca 990521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University