View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18051_high_22 (Length: 217)
Name: NF18051_high_22
Description: NF18051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18051_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 34542649 - 34542844
Alignment:
| Q |
1 |
aacattcgaccctgaaccaaatctcacaccagtaacctgctgcaccatctgccgaaaattcgctgggtccgccgtgatgaaagtcgtctgcgaccgcttc |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34542649 |
aacatttgaccctgaaccaaatctcacaccagtaacctgctgcaccatctgccgaaaattcgctgggtccgccgttatgaaagtcgtctgcgaccgcttc |
34542748 |
T |
 |
| Q |
101 |
gaggcacgtgattttcgcttcgagattttcccagcggcaacacgttgacgttttggagcggaatcatcagatgcggagagactggaaactgtcgga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34542749 |
gaggcacgtgattttcgcttcgagattttcccagcggcaacacgttgacgttttggagcggaatcatcagatgcggagagactggaaactgtcgga |
34542844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University