View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18051_high_23 (Length: 214)

Name: NF18051_high_23
Description: NF18051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18051_high_23
NF18051_high_23
[»] chr2 (2 HSPs)
chr2 (14-97)||(5729459-5729542)
chr2 (167-199)||(5729611-5729643)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 14 - 97
Target Start/End: Original strand, 5729459 - 5729542
Alignment:
14 aaaatacataaatagagaatgcacaactcaagaataattatgttatacttattatttttcttgtgaaagaacacgtaaatcaag 97  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
5729459 aaaatacataaatagagaatgcacaactcaagaataattaggttatacttattatttttcttgtgaaagaacacgtaaatcaag 5729542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 199
Target Start/End: Original strand, 5729611 - 5729643
Alignment:
167 gaagaatcatgataagctttttagcaacctatt 199  Q
    |||||||||||||||||||||||||||||||||    
5729611 gaagaatcatgataagctttttagcaacctatt 5729643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University