View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18051_high_23 (Length: 214)
Name: NF18051_high_23
Description: NF18051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18051_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 14 - 97
Target Start/End: Original strand, 5729459 - 5729542
Alignment:
| Q |
14 |
aaaatacataaatagagaatgcacaactcaagaataattatgttatacttattatttttcttgtgaaagaacacgtaaatcaag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5729459 |
aaaatacataaatagagaatgcacaactcaagaataattaggttatacttattatttttcttgtgaaagaacacgtaaatcaag |
5729542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 199
Target Start/End: Original strand, 5729611 - 5729643
Alignment:
| Q |
167 |
gaagaatcatgataagctttttagcaacctatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5729611 |
gaagaatcatgataagctttttagcaacctatt |
5729643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University