View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18051_high_8 (Length: 391)
Name: NF18051_high_8
Description: NF18051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18051_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 60 - 374
Target Start/End: Original strand, 52564378 - 52564694
Alignment:
| Q |
60 |
atgaccatagagtctactccaataatttaagaagtactaaggtgtaaaaattataannnnnnngacaaaagggtttaaaaattaataatgacaggacata |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52564378 |
atgaccatagagtctactccaataatttaagaactactaaggtgtaaaaattataatttttttgacaaaagggtttaaaaattaataatgacaggacata |
52564477 |
T |
|
| Q |
160 |
tttttgaggaatatatttcactatatgacgagtaggcctggagtagacatgttgccacatatatcttgtgatgatcccattctatccctctcttataatc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52564478 |
tttttgaggaatatatttcactatatgacgagtaggcctggagtagacatgttgccacatatatcttgtgatgatcccattctctccctctcttataatc |
52564577 |
T |
|
| Q |
260 |
ctctttatatattagtggacaaaatgatcaatgaatacattaccgttttatttcagttgc--nnnnnnnnnnnnnctcctactttgcttgcactgattta |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52564578 |
ctctttatatattagtggacaaaatgatcaatgaatacattaccgtttcatttcagttgcatatatatatatacactcctactttgcttgcactgattta |
52564677 |
T |
|
| Q |
358 |
tatctgatctcccttca |
374 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52564678 |
tatctgatctcccttca |
52564694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University