View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18051_low_19 (Length: 237)
Name: NF18051_low_19
Description: NF18051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18051_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 43461797 - 43462008
Alignment:
| Q |
13 |
agagactaaagtgactatttgcacaaatttttattcaatctaatctcttatttgatttgattgatagaaaagaaagaaaaatcaagagccagggatgaat |
112 |
Q |
| |
|
|||||||||||| ||||||||| || |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43461797 |
agagactaaagtaactatttgctcatatttttattcaatctaatatcttatttgatttgattgatagaaaagaaagaaaaatcaagagccagggcggaat |
43461896 |
T |
|
| Q |
113 |
tgtattcttagttactagtatcagtaggaaccgaaccaatgtcttggaataataat-actaaatctggaacgtccattctatgtcgctcattcctctatt |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43461897 |
tgtattcttagttactagtattagtaggaaccgaaccaatgtcttggaataataataactaaatctggaacgtccattctatgtcgctcattcctctatt |
43461996 |
T |
|
| Q |
212 |
ggcgttggattt |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43461997 |
ggcgttggattt |
43462008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University