View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18051_low_20 (Length: 233)
Name: NF18051_low_20
Description: NF18051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18051_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 7 - 203
Target Start/End: Complemental strand, 43588006 - 43587808
Alignment:
| Q |
7 |
gagattatgtcggatgtgaaacctgctctaacttttaaagccaagtcgaaactattgtctcttgagtttgatatattttctcccaccattattcgggaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43588006 |
gagattatgtcggatgtgaaacctgctctaacttttaaagccaagtcgaaactattgtctcttgagtttgatatattttctcccaccattattcgggaga |
43587907 |
T |
 |
| Q |
107 |
aagatacaaggtagaatctatatttatgcc--nnnnnnnnnnnnggcattcttgttagcaagcattatatgagtttactttgattattgttccttattc |
203 |
Q |
| |
|
|| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43587906 |
aatatacaaggtagaatctatatttatgcctttttttttttgttggtattcttgttagcaagcattatatgagtttactttgaatattgttccttattc |
43587808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University