View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18051_low_23 (Length: 220)
Name: NF18051_low_23
Description: NF18051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18051_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 34542619 - 34542435
Alignment:
| Q |
17 |
gcatagggcggtgggagttaacggaggagggaggtttacgactggtggagggtgtttaccgacgcttgacacgtcagcttttttactacaacaccaccac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
34542619 |
gcatagggcggtgggagttaacggaggagggaggtttacgactggtggagggtgtttaccgacgcttgatacgtcagcttttttactacaacacc---ac |
34542523 |
T |
 |
| Q |
117 |
caacagcagcaacaaacaatggtgggtcctaattctgatgggcctgtaatgactgggctgggcccactctctttcggccagcccattg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34542522 |
caacagcagcaacaaacaatggtgggtcctaattctgatgggcctgaaatgactgggctgggcccactctctttcggccagcccattg |
34542435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University