View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18051_low_25 (Length: 217)

Name: NF18051_low_25
Description: NF18051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18051_low_25
NF18051_low_25
[»] chr7 (1 HSPs)
chr7 (1-196)||(34542649-34542844)


Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 34542649 - 34542844
Alignment:
1 aacattcgaccctgaaccaaatctcacaccagtaacctgctgcaccatctgccgaaaattcgctgggtccgccgtgatgaaagtcgtctgcgaccgcttc 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
34542649 aacatttgaccctgaaccaaatctcacaccagtaacctgctgcaccatctgccgaaaattcgctgggtccgccgttatgaaagtcgtctgcgaccgcttc 34542748  T
101 gaggcacgtgattttcgcttcgagattttcccagcggcaacacgttgacgttttggagcggaatcatcagatgcggagagactggaaactgtcgga 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34542749 gaggcacgtgattttcgcttcgagattttcccagcggcaacacgttgacgttttggagcggaatcatcagatgcggagagactggaaactgtcgga 34542844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University