View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18052_high_5 (Length: 249)
Name: NF18052_high_5
Description: NF18052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18052_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 7418841 - 7419074
Alignment:
| Q |
1 |
gatgaaaagaagattgttgatgttgttgtggccatatctcaaaacctttgttgtagatctcttcgtttctgaacaaaaactgattattattatttccact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7418841 |
gatgaaaagaagattgttgatgttgttgtggccatatctcaaaacctttgttgtagatctcttcgtttctgaacacaaactgattattattatttccact |
7418940 |
T |
|
| Q |
101 |
gttgttgttattttcttcttgttctcttgcttcttctttgcctcttccactgcttagagagaagaaaccagccatgttgttttgtaacacaaaaatgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7418941 |
gttgttgttattttcttcttgttctcttgcttcttctttgcctcttccactgcttagagagaagaaaccagccatgttgttttgtaacacaaaaatgaaa |
7419040 |
T |
|
| Q |
201 |
cgatcttccctaattcagttatagttatagcaat |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
7419041 |
cgatcttccctaatttagttatagttatagcaat |
7419074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University