View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18053_high_28 (Length: 248)
Name: NF18053_high_28
Description: NF18053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18053_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 104 - 229
Target Start/End: Complemental strand, 2015607 - 2015482
Alignment:
| Q |
104 |
ccaatgctagatggcaactacatgaaattcgagacatacataataataatactatcttgaaccagcatattaattatagttaacagtaaagtataacccg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2015607 |
ccaatgctagatggcaactacatgaaattcgagacatacataataataatactatcttgaaccagcatattaattatagttaacagtaaagtataacccg |
2015508 |
T |
|
| Q |
204 |
tatgaaactagtgttcagttaaaacc |
229 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
2015507 |
tattaaactagtgttcagttaaaacc |
2015482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University