View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18053_low_25 (Length: 311)
Name: NF18053_low_25
Description: NF18053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18053_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 9 - 295
Target Start/End: Complemental strand, 3225607 - 3225321
Alignment:
| Q |
9 |
agaagaaaacaacacaagaagggaaatgaggcaaaaaggtaaaaaacatgatggaccatgtgaagcaaccaacccaattgatagttgttggaggtgcaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225607 |
agaagaaaacaacacaagaagggaaatgaggcaaaaaggtaaaaaacatgatggaccatgtgaagcaaccaacccaattgatagttgttggaggtgcaaa |
3225508 |
T |
|
| Q |
109 |
gccgattgggctgcgaatcgatttcaattagccaagtgtagtaagggctttggaagaaaggcaactggtgggcttggaggtccaatctatgtggtcactg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225507 |
gccgattgggctgcgaatcgatttcaattagccaagtgtagtaagggctttggaagaaagacaactggtgggcttggaggtccaatctatgtggtcactg |
3225408 |
T |
|
| Q |
209 |
atgagtctgataatgacatggtaaaccctaaacctggaacccttagatttggtgttgtccaaaagggaccattatggatcacttttg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3225407 |
atgagtctgataatgacatggtaaaccctaaacctggaacccttagatttggtgctgtccaaaagggaccattatggatcacttttg |
3225321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University