View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18053_low_29 (Length: 269)
Name: NF18053_low_29
Description: NF18053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18053_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 151 - 259
Target Start/End: Original strand, 2015802 - 2015910
Alignment:
| Q |
151 |
cggcatgagagtggtggctggaaaacggtagatcgttgaatgatggaaacaaactaaaagtcttgcaccataagcttcaaaatcttaccattcacaaggt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2015802 |
cggcatgagagtggtggctggaaaacggtagatcgttgaatgatggaaacaaactaaaagtgttgcaccataagcttcaaaatcttaccattcacaaggt |
2015901 |
T |
 |
| Q |
251 |
ttgcctttg |
259 |
Q |
| |
|
|||| |||| |
|
|
| T |
2015902 |
ttgcttttg |
2015910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 2015652 - 2015770
Alignment:
| Q |
1 |
tgtttgattttaactttctaaaccctnnnnnnnnncttaatattcttcaaaagatcatgtcttctcccacctctgacctattgtgaattttcggcatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2015652 |
tgtttgattttaactttctaaactctaaaaaaaaacttaatattcttcaaaagatcatgtcttctcccacctctgacccattgtgaattttcggcatcaa |
2015751 |
T |
 |
| Q |
101 |
ccttatttcttgttatatc |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2015752 |
ccttatttcttgttatatc |
2015770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University