View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18053_low_31 (Length: 249)
Name: NF18053_low_31
Description: NF18053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18053_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 6720906 - 6720667
Alignment:
| Q |
1 |
aagagtttcataaacaattgttgcatggatggttatattactttgtttcatgaaaaacgtgcaggttcttaccaatggtattgaagtgaagctgcagagg |
100 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6720906 |
aagagtttcacatacaattgttgcatggatggttatattactttgtttcatgaaaaatgtgcaggttcttaccaatggtattgaagtgaagctgcagagg |
6720807 |
T |
|
| Q |
101 |
aatgctcttagtgtgattgaaccaccaaccggtctcgaggaagatgatgaccttgaatttgaaaataccatttggcatggatcagatatgggtgagtttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6720806 |
aatgctcttagtgtgattgaaccaccaaccggtctcgaggaagatgatgaccttgaatttgaaaataccatttggcatggatcagatatgggtgagtttc |
6720707 |
T |
|
| Q |
201 |
aatttgggatgttgctgtgtaattgtatctcttccctttg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6720706 |
aatttgggatgttgctgtgtaattgtatctcttccttttg |
6720667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 60 - 162
Target Start/End: Complemental strand, 52219930 - 52219828
Alignment:
| Q |
60 |
tgcaggttcttaccaatggtattgaagtgaagctgcagaggaatgctcttagtgtgattgaaccaccaaccggtctcgaggaagatgatgaccttgaatt |
159 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||| |||| || || ||| |||||||||||||||||||| |
|
|
| T |
52219930 |
tgcaggttcttactaatggaattgaagtgaagctgcaaaggaatgctcttagtgtgattgaagcacccactggcaacgaagaagatgatgaccttgaatt |
52219831 |
T |
|
| Q |
160 |
tga |
162 |
Q |
| |
|
||| |
|
|
| T |
52219830 |
tga |
52219828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University