View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18053_low_37 (Length: 207)
Name: NF18053_low_37
Description: NF18053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18053_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 189
Target Start/End: Original strand, 31132755 - 31132930
Alignment:
| Q |
14 |
gcaaagggtgatgggcccgacaaaagagatggacaatattaggacaagaatgtcgatgttggcctggagtctgaaagatgtaatctgaggaaaaggattg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31132755 |
gcaaagggtgatgggcccgacaaaagagatggacaatattaggacaagaatgtcgatgttggcctggagtctgaaagatgtaatctgaggaaaaggattg |
31132854 |
T |
 |
| Q |
114 |
ggattgtgctgacaaaactggtacaatcattttctatggagaaaattatttgtgtatggctttaatctgctgaaac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31132855 |
ggattgtgctgacaaaactggtacaatcattttctatggagaaaattatttgtgtatggccataatctgctgaaac |
31132930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University