View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_high_26 (Length: 400)
Name: NF18054_high_26
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 323; Significance: 0; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 37 - 384
Target Start/End: Original strand, 34698212 - 34698559
Alignment:
| Q |
37 |
tatcaaattgcaggttctacaatatataaaagtgtaaatagaatatgtggaactacccttgctggacttctagcctttggtgtacaatgggttgctagta |
136 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698212 |
tatcaaattgcaggttctactatatataaaagtgtaaatagaatatgtggaactacccttgctggacttctagcctttggtgtacaatgggttgctagta |
34698311 |
T |
|
| Q |
137 |
aagcaggaaagcaactggaaccggtaattgttggagtcctactctttctactaggtataatatttataaccaacaataacaatctatatacacactatgg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698312 |
aagcaggaaagcaactggaaccggtaattgttggagtcctactctttctactaggtataatatttataaccaacaataacaatctatatacacactatgg |
34698411 |
T |
|
| Q |
237 |
atcttggtaattgaccatttgatcattacattgtttcatctcnnnnnnnaggttcggcagcgacattctcaagattcatcccaaccataaaggctcgttt |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698412 |
atcttggtaattgaccatttgatcattacattgtttcatctctttttttaggttcggcagcgacattctcaagattcatcccaaccataaaggctcgttt |
34698511 |
T |
|
| Q |
337 |
tgattatggtgttctgatatttatcctaactttcagcttggtttcaat |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698512 |
tgattatggtgttctgatatttatcctaactttcagcttggtttcaat |
34698559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 44 - 205
Target Start/End: Original strand, 34681590 - 34681751
Alignment:
| Q |
44 |
ttgcaggttctacaatatataaaagtgtaaatagaatatgtggaactacccttgctggacttctagcctttggtgtacaatgggttgctagtaaagcagg |
143 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| ||||||| ||||||||||||||| || ||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34681590 |
ttgcaggtgctacaatatacaaaagtgtaaacagaatatttggaactacccttgccgggcttttagcctttggtgtacattgggttgctagtaaagcagg |
34681689 |
T |
|
| Q |
144 |
aaagcaactggaaccggtaattgttggagtcctactctttctactaggtataatatttataa |
205 |
Q |
| |
|
| | ||| |||||| ||||||||||||| | ||||||| ||||||||||||| ||||||| |
|
|
| T |
34681690 |
agatcaatgggaacctgtaattgttggagcctcactctttttactaggtataatttttataa |
34681751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 299 - 382
Target Start/End: Original strand, 34682137 - 34682220
Alignment:
| Q |
299 |
acattctcaagattcatcccaaccataaaggctcgttttgattatggtgttctgatatttatcctaactttcagcttggtttca |
382 |
Q |
| |
|
||||| |||||||| || ||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
34682137 |
acattttcaagatttataccaactataaaggctcgttttgattatggtgctctgatatttatcctcactttcagtttggtttca |
34682220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University