View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_high_32 (Length: 371)
Name: NF18054_high_32
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_high_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 18 - 359
Target Start/End: Complemental strand, 24165875 - 24165534
Alignment:
| Q |
18 |
atttatagtgacttgcttgatagcatccaaatcacgactttctggaagatttagaggtttgaaaatagtcccatgacaagtatcaggctttacactcaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24165875 |
atttatagtgacttgcttgatagcatccaaatcacggctttctggaagatttagaggtttgaaaatagtcccatgacaagtatcaggctttacactcaaa |
24165776 |
T |
|
| Q |
118 |
tcatctgaaataatgaaagatgcagtctctggaacaaacccatcaaaatcaacatttcgatcagtagatgaactttcatgaaatatctctcgattcattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24165775 |
tcatctgaaataatgaaagatgcagtctctggaacaaacccatcaaaatcaacatttcgatcggtagatgaactttcatgaaatatctctcgattcattg |
24165676 |
T |
|
| Q |
218 |
gtttcccacacctgcatttttgattcctgaaagtactcaacaatgcccctggtttacgactacagttccaatcctcacatacaaagtacttcattttctc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24165675 |
gtttcccacacctgcatttttgattcctgaaagtactcaacaatgcccctgatttacgactacagttccaatcctcgcatacaaagtacttcattttctc |
24165576 |
T |
|
| Q |
318 |
tgtgtcatcgatgttaagctttatatgttcgcaatattcttc |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24165575 |
tgtgtcatcgatgttaagctttatatgttcgcaatattcttc |
24165534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University