View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_high_36 (Length: 352)
Name: NF18054_high_36
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_high_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 112 - 337
Target Start/End: Complemental strand, 40042442 - 40042217
Alignment:
| Q |
112 |
tgttaatgtctaaattggtatatggaatgatccaaggggagattactgaaaaagagattatagataatgtggttttgctagtttttgcagctcatgatac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40042442 |
tgttaatgtctaaattggtatatggaatgatccaaggggagattactgaaaaagagattatagataatgtggttttgctagtttttgcagctcatgatac |
40042343 |
T |
|
| Q |
212 |
tacttcttttgctgttgctatgacattcaagatgctggctcaacatcctcattgctatggtaaagttctacaaggtaatatcataatcaatttaattgat |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40042342 |
tacttcttttgctgttgctatgacattcaagatgctggctcaacatcctcattgctatggtaaagttctacaaggtaatatcataatcaatttaattcat |
40042243 |
T |
|
| Q |
312 |
atgcatcaacaacgtaaagatatgat |
337 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40042242 |
atgcatcaacaacgtaaagatatgat |
40042217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University