View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_high_59 (Length: 259)
Name: NF18054_high_59
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_high_59 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 122424 - 122648
Alignment:
| Q |
20 |
aatagaagttccagctctagcctcattgataggtatttttgctggatagctagaggaatgtttcggagttactccacctgatcattatgtaaaaccaact |
119 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
122424 |
aatagaagttccggctctagcctcattgataggtatttttgctggatagctagaggaatgtttcggagttactccacctaatcattatgtaaaaccaact |
122523 |
T |
|
| Q |
120 |
caaattatttgtatgctacatgctaaccttattaatttatgaatatgataacataattcagatacatatagtatgtagactgtagtgatcctagatttcc |
219 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
122524 |
caaattatttgtatgctacacgctaaccttattaatttatgaatatgataacataattcagatacatatagtatatagactgtagtgatcctagatttcc |
122623 |
T |
|
| Q |
220 |
cctaatcactatcaccctagaataa |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
122624 |
cctaatcactatcaccctagaataa |
122648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 33 - 82
Target Start/End: Complemental strand, 7451473 - 7451424
Alignment:
| Q |
33 |
gctctagcctcattgataggtatttttgctggatagctagaggaatgttt |
82 |
Q |
| |
|
|||||||||| ||||||||||||||| || |||||| |||||||||||| |
|
|
| T |
7451473 |
gctctagcctgattgataggtattttagccggatagaaagaggaatgttt |
7451424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University