View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_high_60 (Length: 253)
Name: NF18054_high_60
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_high_60 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 137 - 251
Target Start/End: Complemental strand, 2945556 - 2945445
Alignment:
| Q |
137 |
atattaaatatgtcggctgattcaacatttacttggttgttccctctatggaaataccctccttcgtagccaagttaccctccaaaatggatactatgtg |
236 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2945556 |
atattatatacgtcggctgattcaacatttacttggttgttccctctatggaaataccctccttcgtagccaagttaccctccaaaatgga---tatgtg |
2945460 |
T |
|
| Q |
237 |
atattggagaatatt |
251 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
2945459 |
atgttggagaatatt |
2945445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 29 - 92
Target Start/End: Complemental strand, 2945941 - 2945878
Alignment:
| Q |
29 |
gttaattagaaattagaaatttctactatatacatattgattcgtgttctaaatcacagacgtg |
92 |
Q |
| |
|
|||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2945941 |
gttagttaaaaatttgaaatttctactatatacatattgattcgtgttctaaatcaccgacgtg |
2945878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University