View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_high_70 (Length: 239)
Name: NF18054_high_70
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_high_70 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 40692188 - 40692426
Alignment:
| Q |
1 |
aagaagagtgaaattggatcaattttttagtagaaattgtttggtggaaaatgaattgaatcaaacggagtaagatcaagtgaacttggttcagtagtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40692188 |
aagaagagtgaaattggatcaattttttagtagaaattgtttggtggaaaatgaattgaatcaaacggagtaagatcaactgaacttggttcagtagtta |
40692287 |
T |
 |
| Q |
101 |
ttttcattagaggtaaatggatcagttcctagcattgagaaaatagatcactgacttttttcttttaaaattgaagtatataaatttctgtgacagattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40692288 |
ttttcattagaggtaaatggatcagttcctagcattcagaaaatagatcactgacttttttcttttaaaattgaagtatataaatttctgtgacagattt |
40692387 |
T |
 |
| Q |
201 |
aattggtgtcatgtggtccacttgattcatgaagaatac |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40692388 |
aattggtgtcatgtggtccacttgattcatgaagaatac |
40692426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University