View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_high_83 (Length: 227)
Name: NF18054_high_83
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_high_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 44691299 - 44691519
Alignment:
| Q |
1 |
tctgtctcatgtagaggactattttgtgagggttgagatatatttttactcttagttttacaattggattgtttctgagaaaacacgattccatgaaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44691299 |
tctgtctcatgtagaggactattttgtgagggttgagatatatttttactcttagttttacaattggattgtttctgagaaaccacgattccatgaaggc |
44691398 |
T |
 |
| Q |
101 |
ttctagttctatatctatatgtggcttgtatataaatgtttggtagaaatcgtttaagtcccttgcattccgattttgcctgatataattcatatacttt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44691399 |
ttctagttctatatctatacgtggcttgtatataaatgtttggtagaaatcgtttaagtcccttgcattccgattttgcctgatataattcatatacttt |
44691498 |
T |
 |
| Q |
201 |
gcagcagtgaaaagaaaatgg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44691499 |
gcagcagtgaaaagaaaatgg |
44691519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 115 - 155
Target Start/End: Original strand, 44631196 - 44631236
Alignment:
| Q |
115 |
ctatatgtggcttgtatataaatgtttggtagaaatcgttt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44631196 |
ctatatgtggcttgtatataaatgtttggtcgaaatcgttt |
44631236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University