View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_high_90 (Length: 206)
Name: NF18054_high_90
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_high_90 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 3e-53; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 14 - 123
Target Start/End: Original strand, 5574825 - 5574934
Alignment:
| Q |
14 |
caaaggaccattacagtaagccatggtttagtgaagcctgaactatatgtatatcattatatgaccttattgcagtgagtaggttccaagcctcagtggg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5574825 |
caaaggaccattacagtaagccatggtttagtgaagcctgaactatatgtatatcatcatatgaccttattgcagtgagtaggttccaagcctcagtggg |
5574924 |
T |
|
| Q |
114 |
acgaaattaa |
123 |
Q |
| |
|
|||||||||| |
|
|
| T |
5574925 |
acgaaattaa |
5574934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 83 - 191
Target Start/End: Original strand, 5585799 - 5585902
Alignment:
| Q |
83 |
ttgcagtgagtaggttccaagcctcagtgggacgaaattaatcccaaaatacataatcaatactattatagcaatgcaagacctttcatcaggaatacac |
182 |
Q |
| |
|
||||||||| |||||||||||||||||||| | | |||| ||||||||| ||||| || |||||||| ||| | ||||||||||||||||||| |
|
|
| T |
5585799 |
ttgcagtgactaggttccaagcctcagtggtatggaattcatcccaaaacacatactctcccctattata-----gcatggcctttcatcaggaatacac |
5585893 |
T |
|
| Q |
183 |
cctccaatc |
191 |
Q |
| |
|
||||||||| |
|
|
| T |
5585894 |
cctccaatc |
5585902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 66 - 155
Target Start/End: Original strand, 5581757 - 5581846
Alignment:
| Q |
66 |
atcattatatgaccttattgcagtgagtaggttccaagcctcagtgggacgaaattaatcccaaaatacataatcaatactattatagca |
155 |
Q |
| |
|
||||| ||| |||||| ||||||||||| |||| | |||||||||||| | | || ||||||||| | ||||||| | ||||||||||| |
|
|
| T |
5581757 |
atcataataagaccttgttgcagtgagttggttatatgcctcagtgggatggacttcatcccaaaaaaaataatcactcctattatagca |
5581846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 155
Target Start/End: Original strand, 5580033 - 5580105
Alignment:
| Q |
83 |
ttgcagtgagtaggttccaagcctcagtgggacgaaattaatcccaaaatacataatcaatactattatagca |
155 |
Q |
| |
|
||||| |||||||| ||||||||||||||||| ||| | ||||||| | ||||| ||| | ||||||||||| |
|
|
| T |
5580033 |
ttgcaatgagtaggctccaagcctcagtgggatgaactgcatcccaagacacatattcactcctattatagca |
5580105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University