View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_34 (Length: 370)
Name: NF18054_low_34
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 337; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 20 - 360
Target Start/End: Original strand, 52289976 - 52290316
Alignment:
| Q |
20 |
ttccattctacttgacataaccttcgtttcttttcctctttgattctctgtaatactttgaaacctcactctctcaaccttctttacacgacttagcgtc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52289976 |
ttccattctacttgacataaccttcgtttcttttcctctttgattctctgtaatactttgaaacctcactctctcaaccttctttacacgacttagcgtc |
52290075 |
T |
 |
| Q |
120 |
cttctatttgcgctagttaaatctctattctcctttttatcactaaaatttgagatagccttaactttactgtccatagtactagacgaatggaccttct |
219 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290076 |
cttctatttgcgctagttaaatctttattctcctttttatcactaaaatttgagatagccttaactttactgtccatagtactagacgaatggaccttct |
52290175 |
T |
 |
| Q |
220 |
cgtcttccgagaatcttgctaagcaagaaatcaacgattcactttcctcttcattgattttatcaattagaaactcacttcttcttgaaggaacgtcgga |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290176 |
cgtcttccgagaatcttgctaagcaagaaatcaacgattcactttcctcttcattgattttatcaattagaaactcacttcttcttgaaggaacgtcgga |
52290275 |
T |
 |
| Q |
320 |
tgtacttttccggcctttggatttcactttcttgacctttg |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290276 |
tgtacttttccggcctttggatttcactttcttgacctttg |
52290316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 68
Target Start/End: Original strand, 52289929 - 52289976
Alignment:
| Q |
21 |
tccattctacttgacataaccttcgtttcttttcctctttgattctct |
68 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
52289929 |
tccattctacttgacataaccttcgtttcggttcctcttcgattctct |
52289976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University