View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_44 (Length: 337)
Name: NF18054_low_44
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 46417917 - 46417591
Alignment:
| Q |
1 |
ttctcttatactctctctcttcttcacaaccagtatataaatgcaccaccttctcatttctctctcacaactcaactgaagcattgcaacattggttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46417917 |
ttctcttatactctctctcttcttcacaaccagtatataaatgcaccaccttctcatttctctctcacaactcaactgaagcattgcaacattggttcac |
46417818 |
T |
 |
| Q |
101 |
tcactgttgggtaggtcttgttggagaagcagggcacgtgcaatcgtagaactctctcaaacttcaatctcattttgcacgtgctccacttttccaactt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46417817 |
tcactgttgggtaggtcttgttggagaagcagggcacgtgcaaccgtagatctctctcaaacttcaatctcattttgcacgtgctccacttttccaactt |
46417718 |
T |
 |
| Q |
201 |
gatcttcccaccatctttttatctaattggcataaactggttttggtaagataaggttaattttattttatatcctctccttttatttctaacgtataca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
46417717 |
gatcttcccaccatctttttatctaattggcataaactggttttggtaagataaggttaattttattgtatatcctctccttttatttctaatgtataca |
46417618 |
T |
 |
| Q |
301 |
ctttgttgtactgataatggtcctttg |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46417617 |
ctttgttgtactgataatggtcctttg |
46417591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University