View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_50 (Length: 317)
Name: NF18054_low_50
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 34 - 237
Target Start/End: Original strand, 8943576 - 8943779
Alignment:
| Q |
34 |
atgaaactacaagatcctttatgaaactatttgcaatcattaatgtgtaaaagagtatgttcatgcatattgcataccacaattgatactaaaagcccta |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8943576 |
atgaaactacaagatcctttatgaaactatttgtaatcattaatgtgtaaaagagtatgttcatgcatattgcataccacaattgatactaacagcccta |
8943675 |
T |
|
| Q |
134 |
ccccacataatccatattccatgtttagctctctgcttggttttgttttgtattggtgttggagtaggttttgtattttaagaactctaataatacaaca |
233 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8943676 |
ccccacataatccatattacatgtttagctctctgcttggttttattttgtattggtgtcggagtaggttttgtattttaagaactctaataatacaaca |
8943775 |
T |
|
| Q |
234 |
aagt |
237 |
Q |
| |
|
|||| |
|
|
| T |
8943776 |
aagt |
8943779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University