View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_60 (Length: 272)
Name: NF18054_low_60
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_60 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 13 - 272
Target Start/End: Original strand, 36345216 - 36345475
Alignment:
| Q |
13 |
aaaatcgttattcacatcgatcaattgagacattgatagtggtgatagcagtgatcactatagtaggtgtgattgcaggaatgattgcaaggttgtgtgg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36345216 |
aaaatcgttattcacatcgatcaattgagacattgatagtggtgatagcagtgatcactatagtaggtgtgattgctggaatgattgcaaggttgtgtgg |
36345315 |
T |
 |
| Q |
113 |
tggaagacactttggaggaaatggtgagaatgatatagaaggttgggttgaaaggaagtgtagaagttgcattgatgcaggtcttccaccaccgccgccg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36345316 |
tggaagacactttggaggaaatggtgagaatgatatagaaggttgggttgaaaggaagtgtagaagttgcattgatgcaggtcttccaccaccaccgccg |
36345415 |
T |
 |
| Q |
213 |
ccagctgaacctaaacccgaagagccaaaggcagaaccaaaggcagaagctgcagcagga |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36345416 |
ccagctgaacctaaacccgaagagccaaaggcagaaccaaaggcagaagctgcagcagga |
36345475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University