View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_67 (Length: 247)
Name: NF18054_low_67
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_67 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 247
Target Start/End: Original strand, 8907776 - 8908013
Alignment:
| Q |
10 |
aagaaaatcaagaaggnnnnnnnctattgtgttaacctgttccacaattttttggctatttggtgcattgcactttccaaggatgaaatgtccgcaattt |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8907776 |
aagaaaatcaagaaggaaaaaaactattgtgttaacctattccacaattttttggctatttggtgcattgcactttccaaggatgaaatgtccgcaattt |
8907875 |
T |
 |
| Q |
110 |
tccaccggatcaccataacttgcaaaatccactcgagtaattgttttgctgtccaaacacaccaagtttgctgctggttttggggtgtccacattggtcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8907876 |
cccaccggatcaccataacttgcaaaatccacttgagtaattgttttgttgtccaaacacaccaagtttgctgctggttttggggtgtccacattggtcc |
8907975 |
T |
 |
| Q |
210 |
ttatcacacctttatatctgctcaatgtctcaacattt |
247 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8907976 |
ttatcacacctttatatctgctccatgtctcaacattt |
8908013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University