View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_71 (Length: 242)
Name: NF18054_low_71
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 29 - 141
Target Start/End: Complemental strand, 23171972 - 23171860
Alignment:
| Q |
29 |
gggagaattgaccggagtgcaggtggcttaaacggccttctggaaaacggaaaggtgggagatttaccggagaggtgagacgacgtagtatggaggagaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23171972 |
gggagaattgaccggagtgcaggtgggttaaacgaccttctcgaaaacggagaggtgggagatttaccggagaggtgagacgacgtagtatgaaggagaa |
23171873 |
T |
 |
| Q |
129 |
atggggaagtgaa |
141 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23171872 |
atggggaagtgaa |
23171860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 73 - 126
Target Start/End: Complemental strand, 23220386 - 23220333
Alignment:
| Q |
73 |
aaacggaaaggtgggagatttaccggagaggtgagacgacgtagtatggaggag |
126 |
Q |
| |
|
|||||| || |||||||||||||| | ||||||| |||||||||||| |||||| |
|
|
| T |
23220386 |
aaacgggaaagtgggagatttacctgcgaggtgaaacgacgtagtattgaggag |
23220333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 229
Target Start/End: Original strand, 6395194 - 6395230
Alignment:
| Q |
193 |
tctggaaatttatgagatcccgtaagatcaaaggtaa |
229 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6395194 |
tctggaaatttttgagatcccgtaagatcaaaggtaa |
6395230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University