View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_76 (Length: 238)
Name: NF18054_low_76
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_76 |
 | |
|
| [»] scaffold1808 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 9 - 195
Target Start/End: Original strand, 40692607 - 40692793
Alignment:
| Q |
9 |
aagcggcgtgtccggattcgaaccccagcctctgcatataacaatatgtatgtctctgcaactgagttatgctcacggagacttcatcaatcatatttaa |
108 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
40692607 |
aagcggcgtgtccgggttcgaacctcagcctctgcatataacaatatgtatgtctctgcaactgagttatgttcacggagatttcatcaaccatatttaa |
40692706 |
T |
|
| Q |
109 |
cctcttgttttatttaaaaataatacatacatgcatatttcttggttcacagtatcatatatatcattttcaaattttgatttcatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
40692707 |
cctcttgttttatttaaaaataatacatacatgcatatttcttggttcacagtatcatatatatctttttcaaattttgatctcatt |
40692793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 91
Target Start/End: Complemental strand, 10442946 - 10442878
Alignment:
| Q |
22 |
ggattcgaaccccagcctctgcatataacaatatgtatgtctctgcaactgagttatgctcacggagact |
91 |
Q |
| |
|
|||||||||||||| || || ||||||||||| | ||| ||| | |||||||||||||||||||| |||| |
|
|
| T |
10442946 |
ggattcgaaccccaacccctacatataacaatgtatatctctat-caactgagttatgctcacggtgact |
10442878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1808 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold1808
Description:
Target: scaffold1808; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 881 - 930
Alignment:
| Q |
36 |
gcctctgcatataacaatatgtatgtctctg-caactgagttatgctcacgg |
86 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
881 |
gcctctgcatataacaat--gtatgtccctgacaactgagttatgctcacgg |
930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 91
Target Start/End: Original strand, 3461761 - 3461826
Alignment:
| Q |
25 |
ttcgaaccccagcctctgcatataacaatatgtatgtctctg-caactgagttatgctcacggagact |
91 |
Q |
| |
|
||||||||||| || || ||||||||||| | ||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
3461761 |
ttcgaaccccaacccctacatataacaat--gcatgtccctgtcaactgagttatgctcacggagact |
3461826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University