View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_77 (Length: 238)
Name: NF18054_low_77
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 43200082 - 43199858
Alignment:
| Q |
1 |
cttatcctgtat-ggacacgcttctccggttcacccatgaatcgctgccatctttccaagctcttatcttcggaggattgagtaatttagaaccgagnnn |
99 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43200082 |
cttatcctgtatcggacacgcttctccggttcaccc-tgaatcgctgccatctttccaagctcttatcttcggaggattgagtaatttagaaccgagttt |
43199984 |
T |
|
| Q |
100 |
nnnnctttcgtgcgttttcaaatcaatgaatgaataatctgtgagagctttcttgttttgattgagttatacatttggaaccctagtttgtttgttacgt |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43199983 |
ttttcttttgtgcgttttcaaatcaatgaatgaataatctgtgagagctttcttgttttggttgagttatacatttggaaccctagtttgtttgttacgt |
43199884 |
T |
|
| Q |
200 |
gcgtgctttattattgtgaattgtga |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43199883 |
gcgtgctttattattgtgaattgtga |
43199858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University