View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_78 (Length: 238)
Name: NF18054_low_78
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 38359027 - 38358820
Alignment:
| Q |
13 |
ttattcttgattttatcagcaataggttgacatatttgggcttgcctttgaaaattggaactctaagataagtaaatagaagaaagccaatgttaaaacc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38359027 |
ttattcttgattttatcagcaataggttgacatatttgggcttgcctttgaaaattggaactccaagataagtaaatggaagaaagccaatgttaaaacc |
38358928 |
T |
|
| Q |
113 |
aagatcattagccaattgagtcaatctatgattagtgatagaacatgcaaatatataagattttttaggtttaacaagttggccagaaacttcagcatag |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38358927 |
aagatcattagccaattgaatcaatctatgattactgatagaacatgcaaatatataagattttttaggtttaacaagttggccagaaacttcaccatag |
38358828 |
T |
|
| Q |
213 |
ctgagaaa |
220 |
Q |
| |
|
||||||| |
|
|
| T |
38358827 |
ttgagaaa |
38358820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University