View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_79 (Length: 238)
Name: NF18054_low_79
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_79 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 78 - 219
Target Start/End: Complemental strand, 3002438 - 3002297
Alignment:
| Q |
78 |
ttggtactttcagtaggtctggttctgctctgcggagtattggttttatggttgtcgttggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3002438 |
ttggtactttcagtaggtctggttctactctgcggggtattggttttctggttgtcgtcggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
3002339 |
T |
|
| Q |
178 |
ttgctgcaatttttatttggtcgcttttgcaaggtgtgtgtt |
219 |
Q |
| |
|
||||||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
3002338 |
ttgctgcaatttttatttggttgttttttcaaggtgtgtgtt |
3002297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 78 - 214
Target Start/End: Complemental strand, 3010824 - 3010688
Alignment:
| Q |
78 |
ttggtactttcagtaggtctggttctgctctgcggagtattggttttatggttgtcgttggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| | ||||| |||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
3010824 |
ttggtactttcagtaggtctggttctgctctgcggggtattggttatctggttatcgttggggcgtgctcagtcttagtccgctgatgagaggtgttgtg |
3010725 |
T |
|
| Q |
178 |
ttgctgcaatttttatttggtcgcttttgcaaggtgt |
214 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
3010724 |
ttgctgcaatttttatttggttgtttttgcaaggtgt |
3010688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University