View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18054_low_83 (Length: 234)
Name: NF18054_low_83
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18054_low_83 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 8907990 - 8908205
Alignment:
| Q |
1 |
tatctgctccatgtctcaacatttggaggataatgttctcctactatgctgcaaattgtatctatattgacagttaggatctctataccatctagtttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8907990 |
tatctgctccatgtctcaacatttggaggataatgttctcctgctatgctgcaaattgtatctctattgacagttaggatctctataccatctagtttcc |
8908089 |
T |
|
| Q |
101 |
ctcccatttcctctaacacaaccagaaaattattctttggctgcaagaacgcccttggagtgtgatatctatgaaaacaagacatggaaacaagatttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8908090 |
ctcccatttcctctaacacaaccagaaaattattctttggctgcaagatcgcccttggagtgtgatatctatgaaaacaaaacatggaaacaagatttta |
8908189 |
T |
|
| Q |
201 |
gcttcaactactatca |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8908190 |
gcttcaactactatca |
8908205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University