View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18055_low_16 (Length: 211)
Name: NF18055_low_16
Description: NF18055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18055_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 3 - 192
Target Start/End: Original strand, 6367858 - 6368047
Alignment:
| Q |
3 |
taatgtgccataatttttctattcccttaatgctgctactttnnnnnnntattttaatacattggtatatgaaaaatatatatcttctaattaataattg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6367858 |
taatgtgccataatttttctattcccttaatgctgctactttaaaaaaatattttaatacattggtatatgaaaaatatatatcttctaattaataattg |
6367957 |
T |
 |
| Q |
103 |
aaacgttatccaatcttgaactttaataatgtgtcttatcatttcatatcttcactcataaggaattaaaactgataatgatatataaat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6367958 |
aaacgttatccaatcttgaactttaataatgtgtcttatcatttcatatcttccctcataaggaattaaaactgatcatgatatataaat |
6368047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University