View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18056_high_21 (Length: 278)
Name: NF18056_high_21
Description: NF18056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18056_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 24 - 259
Target Start/End: Complemental strand, 34330009 - 34329774
Alignment:
| Q |
24 |
atgaacaacaattggattaaaaataacattgatcaaacacagaatcatgttgtaacgaaatctcaaaggtttcaaccagtggtaacaacaactgtaagag |
123 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330009 |
atgaacaacaattggattaacaataacattgatcaaacacagaatcatgttgtaacgaaatctcaaaggtttcaaccagtggtaacaacaactgtaagag |
34329910 |
T |
|
| Q |
124 |
tgccttacaccgatggattcacatttccagtgttaaaccctaattcatcttcaacaacaacaaaactcaaaaacggcatcgttttggaagatccaccgag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34329909 |
tgccttacaccgatggattcacatttccagtgttaaaccctaattcatcttcaacaacaacaaaactcaaaaacggcatcgttttggaagatccaccgag |
34329810 |
T |
|
| Q |
224 |
agagtcactggaggttttccgaccaccggaagaact |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34329809 |
agagtcactggaggttttccgaccaccggaagaact |
34329774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University