View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18056_high_26 (Length: 248)
Name: NF18056_high_26
Description: NF18056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18056_high_26 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 3678010 - 3677778
Alignment:
| Q |
17 |
aagatacctcttttgtcttcttannnnnnnnaaaaccaattctttgtagtaaattaatcattcgacgcttttttgacacagtcattttgaaacttgaaag |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3678010 |
aagatacctcttttgtcttcttattttttttaaaaccaattctttgtagtaaattaatcattcgacgcttttttgacacaatcattttgaaacttgaaat |
3677911 |
T |
 |
| Q |
117 |
ggtagtgcatgcaaatgtgaaacacgaattaat-aaaatgattgcccctataagctgttgtataatccattttccatgagcgatggatggaagtggttgt |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3677910 |
ggtagtgcatgcaaatgtgaaacatgaattaataaaaatgattgcccctataagcctttgtataatccattttccatgagcgatggatggaagtggttgt |
3677811 |
T |
 |
| Q |
216 |
ggattagattaatttgttcaccactttaaactt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3677810 |
ggattagattaatttgttcaccactttaaactt |
3677778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University