View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18056_high_29 (Length: 239)
Name: NF18056_high_29
Description: NF18056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18056_high_29 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 38310861 - 38311099
Alignment:
| Q |
1 |
catgtgctacctagttcgcataataaatttagcaaccaaagctttgaatgtgactgccattaataccttctcttgcatagtatacttgtaggcttaacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38310861 |
catgtgctacctagttcgcataataaatttagcaaccaaagctttgaatgtgactgccattaataccttctcttgcatagtatacttgtaggcttaacta |
38310960 |
T |
|
| Q |
101 |
atatactcctagtatttttgtatggtaccacnnnnnnnttaatattttcttatagaagcattccataccttatacctagatatactttaccatcataagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38310961 |
atatactcctagtatttttgtatggtaccacaaaaaaattaatattttcttatagaggcattccataccttatacgtagatatactttaccatcataagg |
38311060 |
T |
|
| Q |
201 |
tagatatctcgagtcttataagcaaaatttcggattcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38311061 |
tagatatctcgagtcttataagcaaaatttcggattcat |
38311099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University