View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18056_high_31 (Length: 237)
Name: NF18056_high_31
Description: NF18056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18056_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 15854275 - 15854495
Alignment:
| Q |
1 |
tatgctcccctcttaaggttatcttaatgtggccggactcttttccctccttcacaaattctgcaacacgcgtggctcgcccaagcaactgcggaaaatg |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
15854275 |
tatgctcccctcttaaggtaatcttaatgtggccggactcttttccctccttcacaaattctgcaacacacgtggctcgcccaagcaactgcagaaaatg |
15854374 |
T |
|
| Q |
101 |
aagttgtcatatgatatggttcaaaactaaactcttgagaagccttagtctgttcaagtgtgggaaaaaacaacaaaccaacctggggctcgccgcatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15854375 |
aagttgtcatatgatatggttcaaaactaaactcttgagaagccttagtctgttcaagtgtgggaaaaaacaacaaaccaacctggggctcgccgcatag |
15854474 |
T |
|
| Q |
201 |
gccaagagcaattgcacatac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
15854475 |
gccaagagcaattgcacatac |
15854495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 10690888 - 10690842
Alignment:
| Q |
175 |
aaaccaacctggggctcgccgcataggccaagagcaattgcacatac |
221 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
10690888 |
aaaccaacctggggctctccgcagaggccaagagcaatagcacatac |
10690842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University