View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18056_low_10 (Length: 407)
Name: NF18056_low_10
Description: NF18056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18056_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 26429917 - 26429708
Alignment:
| Q |
1 |
catctttataatcacttgggataaaattaaattgagccctagttggctttgcctaccaattaaaattttcattataaaggtcacctctaaggagcagttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| | || || ||||||||| |
|
|
| T |
26429917 |
catctttataatcacttgggataaaattaaattgagccctagttggctttgcccaccaattaaaattttcattataacggtcgcttcgaaagagcagttt |
26429818 |
T |
 |
| Q |
101 |
aatccaattgtccttcttccatcaaatcgatccacaataaaat-aaaatagttaacaaaatagata-tccaatctatccatatttaacattaaaggtggt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
26429817 |
aatccaattgtccttcttccatcaaatcgatccacaataaaataaaaataattaacataatagatattccaatctatccatatttaacattaagggtggt |
26429718 |
T |
 |
| Q |
199 |
tagtgatcca |
208 |
Q |
| |
|
|||||||||| |
|
|
| T |
26429717 |
tagtgatcca |
26429708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 309 - 370
Target Start/End: Complemental strand, 26428783 - 26428722
Alignment:
| Q |
309 |
taactacttttgtcaaaggctgtgaattttgtgtgcttatacaatgaaagtggagtaacaca |
370 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
26428783 |
taactactattgtcaaatgcagtgaattttgtgtacttatacaatgaaagtggaataacaca |
26428722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University