View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18056_low_17 (Length: 315)
Name: NF18056_low_17
Description: NF18056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18056_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 41468148 - 41468297
Alignment:
| Q |
1 |
atcttggattaggttctaaagaatttgttagcgtgtaatcgaggtttcacaaaagagtaaaatcgatgttgattacttttgtatgatctcatatacatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468148 |
atcttggattaggttctaaagaatttgttagcatgtaatcgaggtttcacaaaagagtaaaatcgatgttgattacttttgtatgatctcatatacatta |
41468247 |
T |
|
| Q |
101 |
caggacaaaattttatattctttgcagtggtgttgttgattagtacacac |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41468248 |
caggacaaaattttatattctttgcagtggtgttgttaattagtacacac |
41468297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 315
Target Start/End: Original strand, 41468371 - 41468462
Alignment:
| Q |
224 |
agtttatcgtacacctttggttaatcaatgataattatttttatacccatgaatctagacatcaatcaatttacaatgagctcatatttaac |
315 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||| |||||||||| |||||||||||||| ||||||||||| |||||| |
|
|
| T |
41468371 |
agtttatcgtacacctctggttaatcaataataattatttttataccgatgaatctaggcatcaatcaatttataatgagctcatgtttaac |
41468462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University