View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18056_low_35 (Length: 233)
Name: NF18056_low_35
Description: NF18056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18056_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 54916521 - 54916323
Alignment:
| Q |
15 |
caaaggatcggatgcaattactatgaatttacaacgtgaacatgcaaacatcttttacacacacagactcaacgaccgacaatctcattgatctaataat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54916521 |
caaaggatcggatgcaattactatgaatttacaacgtgaacatgcaaacatcttttacacaca--gactcaacgaccgacaatctcattgatctaataat |
54916424 |
T |
 |
| Q |
115 |
tttggattcaaattttttccatatgttaattgcatatatagttaataatttgaagttcgttatcttccctttaatatccactatttttataaaggcacaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54916423 |
tttggattcaaattttttccatatgttaattgcatatatagttaataatttgaagttcgttatcttccctttaatatccactatttttataaaggcacaa |
54916324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University