View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18056_low_36 (Length: 228)
Name: NF18056_low_36
Description: NF18056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18056_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 7161959 - 7162149
Alignment:
| Q |
16 |
ataaatggatttcattcttgtattagttggatcattgagtactagaaatggcagataatggcttcaccttccttcattattagtttctcttgaaatagta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7161959 |
ataaatggatttcattcttgtattagttggatcattgagtactagaaatggcagataatggcttcaccttccttcattattagtttctcttgaaatagta |
7162058 |
T |
|
| Q |
116 |
gatgaagctagtgtatctcaatagttccttagagtagacgaacaaaaatcttggtcaaaaaattctattgttcatatacattttcaaaacc |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7162059 |
gatgaagctagtgtatctcaatggttccttagagtagacgaacaaaaatcttggtcaaaaaattctattgttcatatacattttcaaaacc |
7162149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University