View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18056_low_41 (Length: 212)
Name: NF18056_low_41
Description: NF18056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18056_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 67 - 195
Target Start/End: Complemental strand, 5271291 - 5271163
Alignment:
| Q |
67 |
gtgttgagacagaaaatgggcagtgacaattcaaacgatgatttattgggaggagaagaatgttgtgaaagagaagggaaagggaaaaggttatggaaga |
166 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5271291 |
gtgttgagacagaaaatgggtagtgacaattcaaacgatgatttattgggaggagaagaatgttgtgaaagagaagggaaagggaaaaggttatggaaga |
5271192 |
T |
 |
| Q |
167 |
aggtcaagtatcagcttgttgaatatcat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5271191 |
aggtcaagtatcagcttgttgaatatcat |
5271163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University