View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18056_low_43 (Length: 201)
Name: NF18056_low_43
Description: NF18056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18056_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 26 - 185
Target Start/End: Complemental strand, 41468060 - 41467901
Alignment:
| Q |
26 |
cagctccagaagaagtattagtttgtaaagataaaatcagctccaacaagagtataacattgatatgttcttgtttcctcttctcgtgtgttgcttcatt |
125 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468060 |
cagctccaaaagaagtattagtttgtaaagattaaatcagctccaacaagagaataacattgatatgttcttgtttcctcttctcgtgtgttgcttcatt |
41467961 |
T |
|
| Q |
126 |
gattccaaaagaattttgttgatacccgtccattgatttacctatctattaggtagtaca |
185 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
41467960 |
gattccaaaagaattttgttgatacccatccattgatttacctatctcttaggtagtaca |
41467901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University