View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18058_high_15 (Length: 376)
Name: NF18058_high_15
Description: NF18058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18058_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 15 - 365
Target Start/End: Complemental strand, 9689073 - 9688723
Alignment:
| Q |
15 |
agaaatggtttgaacaatttcttaaacacctttcgaaaaccggaaccgcgacaacgtcgtccttgcttcacctcctgagtcacaagaggaatggttggag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
9689073 |
agaaatggtttgaacaatttcttaaacacctttcgaaaaccggaaccgcgacaacgtcgtccttgcttcacctcctgagtcacaaggggaattgttggag |
9688974 |
T |
|
| Q |
115 |
cagcattaacaagtcttgattgagacactgaccttagaaatcttggttctgataagcttctagataacatggctttgttgagttgagactcaaaagatag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9688973 |
cagcattaacaagtcttgattgagacactgaccttagaaatcttggttctgataagcttcttgataacatggctttgttgagttgagactcaaaagatag |
9688874 |
T |
|
| Q |
215 |
cctctcaaattggtctaacaaagtgctttgttcatctccaaatctctttcgaatcattgctatttcatccatattggttattgatttccaaattgttgtt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9688873 |
cctctcaaattggtctaacaaagtgctttgttcatctccaaatctctttcgaatcattgctatttcatccatattggttattgttttccaaattgttgtt |
9688774 |
T |
|
| Q |
315 |
gatgatgatatatacacaaaaatacaaagtggcattagaggcttaaagggg |
365 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9688773 |
gatgatgatatatacacaaaaacacaaagtggcattagaggcttaaagggg |
9688723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University