View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18058_high_27 (Length: 274)
Name: NF18058_high_27
Description: NF18058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18058_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 258
Target Start/End: Original strand, 41066093 - 41066344
Alignment:
| Q |
7 |
gtagcaaaggtcaagagtaactagagatgacaagtttccaactgaacttggaatctcacctgtgagatttccatttgagacgacaagagttgtaaggtgg |
106 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41066093 |
gtagctaagatcaagagtaactagagatgacaagtttccaactgaacttggaatctcacctgtgagatttccatttgagatgacaagagttgtaaggtgg |
41066192 |
T |
 |
| Q |
107 |
ttaaaagaaagaaactgtgtagggaatccgctatgaagatcgatcgatgttattacgatctcttcaacaaactcctctgcagaacattttatataatccc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41066193 |
ttaaaagaaagaaactgtgtagggaatccgctatgaagatcgatcgatgttattacgatctcttcaacaaactctgctgcagaacattttatataatccc |
41066292 |
T |
 |
| Q |
207 |
atctgcaaggatttttgtgagttggatcccatgatgagaaagtagtggtagg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066293 |
atctgcaaggatttttgtgagttggatcccatgatgagaaagtagtggtagg |
41066344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University