View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18058_high_33 (Length: 250)
Name: NF18058_high_33
Description: NF18058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18058_high_33 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 12274532 - 12274295
Alignment:
| Q |
13 |
aaaataattaattaaagcaacaatctattattttacatcctaatgttttgaagaataattcaaatacataacaatgtaataaaaatagctaggactgatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274532 |
aaaataattaattaaagcaacaatctattattttacatcctaatgttttgaagaataattcaaatacataacaatgtaataaaaatagctaggactgatt |
12274433 |
T |
|
| Q |
113 |
gtgtaccctcgaatagccatttggcatgtcttgaatcacacagccagaggaccttctgcagtatttgggacaagaattgtgaaagttttgttggaagcta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274432 |
gtgtaccctcgaatagccatttggcatgtcttgaatcacacagccagaggaccttctgcagtatttgggacaagaattgtgaaagttttgttggaagcta |
12274333 |
T |
|
| Q |
213 |
tcaacaggaaaatcaacaatggcccaggttccttcctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274332 |
tcaacaggaaaatcaacaatggcccaggttccttcctc |
12274295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University