View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18058_high_42 (Length: 218)
Name: NF18058_high_42
Description: NF18058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18058_high_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 135 - 205
Target Start/End: Complemental strand, 25993605 - 25993535
Alignment:
| Q |
135 |
taattttatggtatgattgaccgtttgtgtatgtagtgtccaaaataaacatatctatctaactctctgct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||| |
|
|
| T |
25993605 |
taattttatggtatgattgaccgtttgtgtatgtagtgtccaaaatgaacataactatctaactttctgct |
25993535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 135 - 198
Target Start/End: Complemental strand, 25989513 - 25989450
Alignment:
| Q |
135 |
taattttatggtatgattgaccgtttgtgtatgtagtgtccaaaataaacatatctatctaact |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
25989513 |
taattttatggtatgattgaccatttgtgtatgcagtgtccaaaatgaacatatctatctaact |
25989450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 185
Target Start/End: Complemental strand, 4571093 - 4571043
Alignment:
| Q |
135 |
taattttatggtatgattgaccgtttgtgtatgtagtgtccaaaataaaca |
185 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| |||||||||||| |||| |
|
|
| T |
4571093 |
taattttatggtatggttgactatttgtgtatgcagtgtccaaaatgaaca |
4571043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University